| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Applied and Environmental Microbiology, July 2008, p. 3921-3934, Vol. 74, No. 13
0099-2240/08/$08.00+0 doi:10.1128/AEM.00314-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Department of Microbiology,1 Alimentary Pharmabiotic Centre,2 School of Pharmacy, University College Cork, Cork, Ireland3
Received 6 February 2008/ Accepted 16 April 2008
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Due to the risk related to L. monocytogenes infections, understanding the molecular basis of virulence is of the utmost importance. In 2001, the genome sequence of the prototype L. monocytogenes serotype 1/2a strain EGDe (27) was published, which heralded the launch of the postgenomic era for L. monocytogenes research. Three years later the complete sequence of the epidemic serotype 4b clone F2365 was deciphered, along with 8x coverage of an additional serotype 1/2a and 4b strain (50). In the same year the partial sequence of a serotype 4b isolate from the Institute Pasteur was also published (19). More recently, a bank of 16 animal, food, and environmental L. monocytogenes isolates, including the widely used virulent 10403S strain, were sequenced by the BROAD Institute (http://www.broad.mit.edu). The resulting sequences should provide an invaluable source of information for identification of genetic determinants involved in the pathogenicity and environmental biology of the organism.
To capitalize on the enormous amount of data obtained from the sequencing projects, molecular tools for improved genetic manipulation of L. monocytogenes have been specifically developed for this organism (10, 13, 37) or adapted from tools for other low-G+C-content gram-positive bacteria (5, 57). L. monocytogenes is a genetically tractable organism with no restriction-modification barriers to hinder the uptake of foreign plasmid DNA. However, as this bacterium is not naturally competent (or the conditions for competence have not been identified), the low electroporation efficiency of the commonly used strains (EGDe and 10403S) has limited electroporation as a means of DNA transfer, particularly in instances where efficient delivery of DNA is a prerequisite (37). While conjugative DNA transfer is also applicable to L. monocytogenes, it is time-consuming compared to electroporation and requires the recipient strain to be marked with a selectable drug marker.
The ability to manipulate chromosomally encoded genes and to control gene expression within a bacterium is a fundamental tool for dissecting the biology of the organism. Overexpression systems in L. monocytogenes have been developed using increased copy numbers of a gene (supplied on a multicopy plasmid) and/or "constitutive" promoters to improve overall levels of gene expression (16, 18, 20, 69). However, problems can arise due to the burden of plasmid maintenance, which can decrease the growth rate and cause plasmid instability in the absence of antibiotic selection, which is especially important in animal models (2, 26). Inducible gene expression systems have previously been described for Listeria, based on the isopropyl-β-D-thiogalactopyranoside (IPTG)-inducible Lac system and the site-specific integrative vector pPL2 (17). Adaptation of the widely used PSPAC promoter from Bacillus subtilis phage SPO-1, which works well in other gram-positive bacteria (25, 39, 71), resulted in only low-level gene expression in L. monocytogenes (44; data not shown). Recently, in Mycobacterium smegmatis, the highly expressed ribosomal protein S1 promoter was modified to develop a conditional expression vector for complementation of an inactivated copy of the essential preprotein translocase, SecA (29).
Here, we describe protocols and tools for four aspects of L. monocytogenes genetic manipulation: (i) an improved electroporation protocol, (ii) a suite of site-specific integrative vectors created for complementation, overexpression, and IPTG-inducible gene expression, (iii) a lactococcal system adapted for rapid chromosomal mutagenesis, and (iv) a streamlined essential gene deletion protocol.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Preparation of electrocompetent L. monocytogenes.
A shaken overnight BHI culture was diluted 1:100 in 500 ml of BHI containing 500 mM sucrose (autoclaved) (BHIS), resulting in an initial optical density at 600 nm (OD600) of 0.01 to 0.02, and then grown to an OD600 of 0.2 to 0.25, as determined with a Biophotometer (Eppendorf). Ampicillin was added to a final concentration of 10 µg/ml (100 µl of a 50-mg/ml solution, freshly constituted), and the culture was incubated with shaking for a further 2 h. During this period there was a doubling of the cell density. Cells were cooled on ice for 10 min and centrifuged (5,000 x g for 10 min at 4°C). Cell pellets were resuspended in 500 ml (total volume) of ice-cold sucrose-glycerol wash buffer (SGWB) (10% glycerol, 500 mM sucrose; pH adjusted to 7 with 100 mM NaOH; filter sterilized) by swirling on ice. Cells were centrifuged two more times; they were resuspended in 175 ml of SGWB after the first centrifugation and in 50 ml of SGWB after the second centrifugation. An optimized concentration of filter-sterilized lysozyme (40,000 to 45,000 U per mg; hen egg white; crystallized three times; Sigma) was added (for strains EGDe and 10403S, 10 µg/ml [50 µl of a 10-mg/ml solution, freshly constituted]; for F2365, 25 µg/ml) and incubated at 37°C for 20 min. Cells were centrifuged (3,000 x g for 10 min at 4°C) and resuspended in 20 ml SGWB. Cells were finally centrifuged, the final volume was adjusted to 2.5 ml by pipetting, and 50-µl aliquots were frozen at –80°C.
Electroporation of L. monocytogenes.
A 50-µl aliquot of electrocompetent cells was mixed with 1 µg of pellet paint-precipitated (Novagen) plasmid DNA and incubated on ice for 5 min. The mixture was transferred to a chilled 1-mm electroporation cuvette (Bio-Rad) and pulsed at 10 kV/cm, 400
, and 25 µF. Time constants between 7 and 8 ms were observed with the protocol described above. To regenerate the cells, 1 ml of room temperature autoclaved BHI that was subsequently supplemented with 500 mM sucrose and then filer sterilized was pipetted immediately into the cuvette and incubated statically at 30°C for 1.5 h. Regenerated cells were diluted in BHIS and plated on BHI agar containing the selective antibiotic.
pORI280 chromosomal mutagenesis protocol.
We used the pORI-based repA-negative plasmid system for rapid deletion or site-directed mutagenesis of Listeria genes (see Fig. 4 and 5) (41). Gene deletions were constructed by splice overlap extension (SOE) PCR (34) to generate two 400-bp fragments: one upstream including the ATG codon or a point mutation (AB product) and one downstream beginning from the stop codon (CD product) or directly after the point mutation (with a 20-bp tail on the C primer complementary to the B primer). The initial PCR products were diluted 1:20 in PCR-grade water, and 1 µl of each product was used as a template in a second round of PCR with the AD primers to generate an 800-bp product. The SOE PCR product was cloned into the multiple cloning site (MCS) of pORI280, and the sequence of the cloned product was verified (MWG Biotech, Germany) with MCS primers (forward primer TATCGATGCATGCCATGGTACC and reverse primer CGCCAGGGTTTTCCCAGTCACGAC). The plasmid was cotransformed into L. monocytogenes with the highly temperature-sensitive plasmid pVE6007 (47) supplying RepA in trans. Transformants were selected on BHI agar containing erythromycin at a concentration of 5 µg/ml and X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) (Calibochem, Merck) at a concentration of 100 µg/ml. For deletion of essential genes, the IPTG-inducible plasmid pIMK4 (containing the gene to be deleted) (see below) was also included in the electroporation mixture along with kanamycin at a concentration of 50 µg/ml. Plates were incubated at 30°C for 48 h.
|
|
Construction of pIMK, a kanamycin site-specific integrative plasmid.
The Listeria vector pPL2 utilizes the site-specific integrase of the PSA phage to direct integration of the vector into the tRNAArg locus on the L. monocytogenes chromosome (between the lmo1240 and lmo1241 genes in EGDe) (37). The derivative vector pIMK was generated by SOE PCR to decrease the plasmid size and to change the antibiotic selection. Initially, three fragments were PCR amplified: (i) a 171-bp fragment encoding the pBluescriptII KS(+) MCS taken from pPL2 (primers IM203 and IM204 [Table 2]), (ii) the backbone region of pPL2 from nucleotide 1100 to nucleotide 4585 (GenBank accession number AJ417449 nucleotide numbering) (primers IM205 and IM211), and (iii) the aphA3 kanamycin resistance gene from pTV1-OK (primers IM207 and IM208) (30).
|
|
Construction of pIMK3 and pIMK4, two IPTG-inducible plasmids.
The Phelp promoter was joined to the LacI repressor from pLIV2 by SOE PCR (with primers IM200 and IM108 (10) and primers IM201 and IM202) and then cloned into the SalI/KpnI restriction sites of pIMK-rrnB. The Phelp promoter was PCR amplified from an oligonucleotide tiling template (with oligonucleotides IM214 through IM225) (59) to include the consensus lacOid LacI repressor binding site (51), separating the mapped transcription start site of PCP25 and the 5' untranslated region of hlyA. The product was cloned as a SacI/BamHI fragment, creating pIMK3. A second lacOid repressor was introduced upstream of the –35 region by PCR amplification of the pIMK3 promoter (using pIMK3 as the template and primers IM327 and IM220) and cloned as a SacI/BamHI fragment, generating pIMK4.
Overexpression and IPTG inducibility: vector testing.
To test the function of the IPTG-inducible (pIMK3 and pIMK4) and Phelp-driven overexpression (pIMK2) constructs, the following three regions were PCR amplified: luxABCDE from pPL2lux (with IM319 and IM319a) (10), full-length P60 gene (with IM333 and IM334), and internalin A gene from EGDe genomic DNA (with IM194 and IM188). All three regions were cloned as NcoI/PstI fragments into the three vectors.
(i) Luciferase expression.
Overnight precultures of EGDe, EGDe::pIMK4lux, EGDe::pIMK3lux, and EGDe::pIMK2lux were diluted 1:100 in fresh BHI containing different concentrations of IPTG and grown statically (200-µl aliquots in triplicate) at 37°C in either Costar black 96-well plates (incubated in an IVIS100 in vivo imager [Xenogen]) or Costar clear-bottom 96-well plates (incubated in a Spectramax M2 plate reader [Molecular Devices]). Readings were taken every 30 min for 10 h, with the IVIS100 acquiring luminescence readings for 5 min at a binning of 8 and the plate reader determining the OD600. As a control for luciferase expression and the effect on the growth rate, EGDe transformed with pIMK3 was included. There was a minimal effect on the growth rate due to luciferase expression, and for all samples EGDe::pIMK3 was used for subtraction of the background luminescence.
(ii) Western blotting of P60 secretion.
Overnight precultures of EGDe, EGDe
p60, EGDe
p60::pIMK4p60, EGDe
p60::pIMK3p60, EGDe
p60::pIMK2p60, and EGDe::pIMK2p60 were grown in filter-sterilized BHI at 37°C with shaking. Precultures were diluted 1:50 in 25 ml of fresh medium containing either no IPTG or 1 mM IPTG, grown as described above to exponential phase (OD600, 1.0), and harvested by centrifugation (7,000 x g for 10 min). The supernatant samples were subsequently processed as described previously (49).
(iii) Invasion assays.
The human colonic Caco-2 cell line (HTB-37; ATCC) was seeded at a density of 1 x 105 cells per well in Primera 24-well tissue culture plates (Falcon) and grown to confluence at 37°C in the presence of 5% CO2 in Caco-2 medium (Dulbecco modified Eagle medium [DMEM] containing 10% fetal calf serum, 1% nonessential amino acids, and a penicillin/streptomycin mixture). On the day prior to use, the medium was changed to antibiotic-free Caco-2 medium and, before invasion, washed twice with 1 ml prewarmed DMEM. Overnight BHI precultures of EGDe, EGDe
inlA, EGDe
inlA::pIMK4inlA, EGDe
inlA::pIMK3inlA, and EGDe
inlA::pIMK2inlA were diluted to obtain an initial OD600 of 0.1 (
30-fold) in the presence of various concentrations of IPTG (0, 0.01, 0.1, 1, and 10 mM) and grown to exponential phase (OD600, 0.8 to 1.0). Cells were washed twice in prewarmed DMEM and diluted 1:100 to obtain an initial inoculum of 1 x 107 CFU/ml (multiplicity of infection, 10). A 1-ml aliquot was added to the Caco-2 cells (in quadruplicate) and incubated for 1 h at 37°C in the presence of 5% CO2, and then each preparation was washed once with Dulbecco's phosphate-buffered saline (PBS) (Sigma) before it was overlaid with 1 ml of DMEM containing 10 µg/ml of gentamicin. After 1 h of incubation at 37°C in the presence of 5% CO2, the Caco-2 cells were washed twice with PBS before the monolayer was lysed with 1 ml of sterile distilled water. Cells were incubated for 1 h at 4°C, vortexed using the shake setting (Scientific Industries) for 15 s, and then diluted in PBS and plated onto BHI agar. Agar plates were incubated overnight at 37°C.
Nucleotide sequence accession number.
The nucleotide sequence of pIMK has been deposited in the EMBL nucleotide sequence database under accession number AM940000.
| RESULTS |
|---|
|
|
|---|
After a series of SOE PCRs, we replaced both chloramphenicol acetyltransferase (CAT) markers of pPL2 with a single kanamycin resistance gene to create pIMK (Fig. 1A). In brief, the pBluescriptII KS MCS was joined to the E. coli origin of replication end of the pPL2 backbone (finishing with the PSA integrase), thereby removing the gram-positive and gram-negative CAT genes. The aphA3 resistance cassette (encoding kanamycin resistance) was amplified from pTV1-OK and joined to the PSA integrase end of the previous PCR product and circularized. This kanamycin-resistant vector is 1 kb smaller than pPL2 and is compatible with the systems currently used to create chromosomal mutations in L. monocytogenes (pMAD [4], pAUL-A [14], pGM [43], pLSV1 [54], pORI19 [57], and pKSV7 [66]), and it allows further manipulation with other plasmids based on alternative antibiotic selection (e.g., erythromycin, chloramphenicol, or tetracycline selection).
New IPTG-inducible and overexpression constructs.
We used the recently created, highly expressed Phelp promoter (59) to obtain three levels of gene expression; (i) constitutive overexpression (pIMK2) (Fig. 1B); (ii) high-level IPTG-inducible expression (pIMK3 [one lacOid site]) (Fig. 1C); and (iii) low-level, strictly controlled IPTG-inducible gene expression (pIMK4 [two lacOID sites]) (Fig. 1D). The rrnB transcription terminators were cloned upstream of the promoter to minimize readthrough, and one of the three promoters described above was cloned downstream. For both IPTG-inducible constructs, the Phelp promoter fused to the lacI repressor was cloned at the opposite end of the MCS, leaving a number of restriction sites for cloning purposes. A unique NcoI site was introduced that overlapped the ATG of Phelp, which allowed in-frame cloning of genes (without their associated ribosome binding sites [RBS]) for functional analysis.
We employed three assays to test the system: (i) a translational fusion with the gram-positive optimized luciferase operon from Photorhabdus luminescens; (ii) qualitative Western blotting of P60 secretion; and (iii) a quantitative screen of internalin A-mediated invasion of Caco-2 cells.
The levels of pIMK2lux-driven luciferase were equivalent to the Phelp-LUX expression data of Riedel et al. (59). The level of luminescence from the pIMK3lux construct was 10-fold less than that from Phelp, with maximal induction occurring in media containing 1 mM IPTG. Luciferase production from EGDe::pIMK4lux was at the limit of detection, so additional assays were performed to compare the levels of gene expression.
The cell wall hydrolytic protein P60 (encoded by the p60 gene, also known as cwhA or iap) is the most abundant protein secreted by L. monocytogenes in rich laboratory media and is essential for full virulence of the pathogen (42). To test the expression system, we cloned the full-length p60 gene behind the three promoters and assayed the levels of P60 expression in wild-type strain EGDe and the corresponding p60 deletion mutant transformed with the three plasmids. Previous attempts to complement an EGDe p60 deletion mutant proved to be difficult; one group had to repair the original deletion (54), while a second group was unable to obtain E. coli transformants of p60 in pPL2 (46). We found that a functional p60 gene could be successfully cloned into E. coli XL1-Blue; however, the growth of the strains harboring the gene was affected. Transformation of EGDe
p60 with the p60 gene expressed from pIMK2 resulted in a fully complemented strain (Fig. 2A). When the mutant was transformed with an IPTG-dependent plasmid (pIMK3p60 or pIMK4p60), overlapping levels of P60 expression were obtained, since fully induced pIMK4p60 produced levels greater than the levels produced by uninduced pIMK3p60. However, full complementation was not achieved. As determined by microscopy, the P60 deletion mutant exhibited a long-chain phenotype (Fig. 2A). Increasing the level of P60 expression resulted in incremental decreases in cell chain length (Fig. 2A). In the case of EGDe
p60::pIMK3p60 with 1 mM IPTG, single cells were observed; however, the morphology of these cells did not completely resemble the wild-type morphology. At this concentration there was still threefold less P60 expression than in wild-type strain EGDe and fourfold less than in the pIMK2 overexpression strains (quantified by NIH Image 1.63). This was manifested by curved single and paired cells instead of the wild-type rod-shaped single and paired cells (Fig. 2A).
|
inlA::pIMK4inlA strain exhibited low residual invasion in the absence IPTG; the level was 3.6 ± 2.92 log10 CFU per well, which was very similar to the value for the
inlA strain (3.49 ± 2.5 log10 CFU per well) (Fig. 2B). Addition of 0.1 and 1 mM IPTG to the pregrowth medium stimulated invasion 5.5- and 35-fold, respectively. No further increase in invasion was observed with higher concentrations of IPTG (data not shown). The kinetics of invasion of wild-type strain EGDe or EGDe
inlA::pIMK2inlA grown in the presence and in the absence 1 mM IPTG were very similar, suggesting that inclusion of IPTG in the preculture does not impact the invasion process.
The EGDe
inlA::pIMK3inlA construct exhibited leaky expression in the absence of IPTG (as previously observed for P60 [Fig. 2A]); however, the level of invasion was lower than that observed for pIMK4inlA with full induction (20.5-fold increase in invasion for pIMK3inlA and 35-fold increase in invasion for pIMK4inlA compared with uninduced pIMK4inlA). For the pIMK3inlA construct, invasion was simulated 10.5-, 28-, and 37-fold using 0.1, 1, and 10 mM IPTG, respectively, compared to uninduced pIMK3inlA. A dynamic range of invasion of 540-fold was determined by dividing the invasion of pIMK3inlA induced with 10 mM IPTG by the invasion of uninduced pIMK4inlA. Expression of inlA from the unmodified Phelp promoter (pIMK2) led to a further 2.5-fold stimulation of invasion compared with fully induced pIMK3inlA. The discrepancy in the difference between the maximal expression of pIMK2 and the expression of fully induced pIMK3 (luciferase, 10-fold; P60, 4-fold; and InlA, 2.5-fold) may have been due to additional processing components required for the correct localization of P60 or internalin A protein or possible saturation of the assay during gentamicin protection (increasing the multiplicity of infection did not increase the numbers of EGDe
inlA::pIMK2inlA recovered from the Caco-2 cells [data not shown]). In conclusion, the constructs described here allow dramatic manipulation of L. monocytogenes gene expression.
Optimization of L. monocytogenes electroporation.
The electroporation method of Park and Stewart for the transformation of L. monocytogenes (53) has been cited in over 100 Listeria research papers (ISI Web of Knowledge). With the strain of L. monocytogenes used in the study of Park and Stewart (ATCC 23074), transformation efficiencies of up to 6.6 log10 CFU/µg of plasmid DNA were achieved. In our hands, EGDe, a commonly used strain of L. monocytogenes (27) whose genome has been sequenced, was poorly transformable. Maximal transformation efficiencies of 4.7 log10 CFU/µg were obtained with a 3-kb lactococcal shuttle vector, pNZ8048 (48) (Fig. 3A). When the site-specific integrative plasmids pPL2 (6.1 kb) (37) and pPL2lux-Phelp (11.8 kb) (59) were used, a drastic decrease in efficiency resulted in values of less than 100 and 0 to 2 CFU/µg, respectively (Fig. 3A). This poor transformation efficiency is consistent with the results of other workers (3, 12, 52), who took advantage of the mobilizable nature of pPL2 (rather than electroporation) to transfer the plasmid into EGDe and the recently sequenced strain 10403S.
|
Gene deletion and site-directed chromosomal mutagenesis.
Listeria researchers have utilized a number of strategies and vectors to create chromosomal mutations (4, 11, 43, 54). Here we added to the repertoire through implementation of the pORI system originally developed with L. lactis (38). The pORI vectors have been thoroughly reviewed by Leenhouts et al. (41). Briefly, pORI vectors contain no origin of replication and require the replication initiation protein, RepA, to be supplied in trans for plasmid maintenance. In E. coli, a host strain containing the repA gene integrated into the chromosome is used for cloning purposes and plasmid propagation. For mutagenesis, the construct is transferred to the recipient strain with a temperature-sensitive helper plasmid expressing RepA. The deletion or mutagenesis proceeds through a forced single-crossover event due to a temperature shift (nonpermissive for the helper plasmid [36, 41]), followed by a period of nonselective growth that stimulates the loss of the integrated plasmid and results in the generation of either a wild-type or mutated sequence (theoretically at a ratio of 50:50).
Here we used a two-plasmid system consisting of pORI280, which contains a constitutively expressed lacZ gene that allows discrimination of strains containing the integration plasmid, and the highly temperature-sensitive RepA+ helper plasmid pVE6007. An SOE PCR deletion construct (containing fused regions from each side of the preferred deletion event) was cloned into pORI280 (Fig. 4 and 5) and transformed, with pVE6007, into the target strain. The initial integration event was selected by a shift to a nonpermissive temperature for pVE6007 replication. In EGDe, we found that pVE6007 was unable to replicate at 37°C; therefore, we could simplify the integration event by performing a complex streak from a single colony from the initial transformation plate onto BHI agar containing erythromycin (5 µg/ml) and X-Gal (100 µg/ml). This step had the additional benefit of decreasing the selection pressure for a dominant crossover (Fig. 4, AB versus CD) that could arise during growth in broth (through growth retardation) and thus improved the frequency of crossover identification (data not shown). Colonies from the plate were scored for loss of pVE6007 (Cms), and subsequently one light blue colony and one dark blue colony (usually corresponding to AD and CD crossovers) were passaged five times at 37°C. Diluted cells from each passage were plated onto BHI agar containing X-Gal, and white colonies were screened by colony PCR with primers E and F to identify mutants (Fig. 4). These steps were all optimized for creation of the previously described p60 and inlA deletion mutants. From the start of cloning to creation of the mutant, the procedure could routinely be completed in 10 to 14 days, and there was a reduction in the number of passages in rich media compared to the results with other vectors in our hands (data not shown).
The procedure described above can also be used for creation of point mutations, as shown in Fig. 5. We used the protocol described above to recreate a series of prfA "star" mutants (60). In brief, these mutants were isolated by fusing the hemolysin promoter to a CAT gene (phlyC) and plating on BHI agar containing chloramphenicol at a concentration of 50 µg/ml (the EGDe::phlyC strain is unable to grow at a chloramphenicol concentration greater than 7.5 µg/ml). The prfA gene was sequenced for all 20 spontaneously arising chloramphenicol-resistant colonies (from three separate experiments), all of which had point mutations in prfA. Only one (G145S) of the six prfA star mutants identified in this manner has been described previously (60). Two additional mutants were shown to have a mutation at the same nucleotide as G145S, resulting in introduction of a different amino acid (cysteine or asparagine instead of glycine). All six point mutations were reintroduced into the chromosome of EGDe using the protocol for gene deletion to create an allelic exchange (Fig. 5). The phenotypes of the three G145 mutants and the L148P mutant were identical in that they showed elevated secretion of HlyA, PlcA, and PlcB (Fig. 5). Two additional mutants (S71C and A94T) had less dramatic phenotypes for virulence gene expression, with only a slight increase in hemolysis on BHI agar containing sheep blood.
Essential gene deletion through "IPTG dependence" confirms that SecA is essential in EGDe.
Since the majority of the gene deletion vectors currently used in Listeria research are based on selection with chloramphenicol or erythromycin, the kanamycin-based pIMK inducible vectors permit investigation of whether a particular gene is "essential." Here we showed that the cytoplasmic preprotein chaperone, encoded by secA, which is essential in all bacteria examined previously (62), is also essential in L. monocytogenes. Initially, a promoterless copy of the secA gene was cloned into pIMK4 and electroporated (along with pORI280
secA and pVE6007) into EGDe, providing a chromosomally located IPTG-inducible copy of secA. Then, the secA gene from the start codon (ATG) to the stop codon (TAA) was deleted at its original location, using the pORI280 protocol. After the transformation all plates and broth media had to contain 1 mM IPTG and 50 µg/ml kanamycin. The resulting strain had only one copy of secA, and this copy was under the control of the IPTG-inducible promoter, creating a conditional or IPTG-dependent mutant (Fig. 6A). This strain was assayed to determine (i) its ability to grow on agar plates containing different concentrations of IPTG and (ii) the effect of withdrawal of IPTG on growth in broth. As shown in Fig. 6C, cells were unable to form colonies at an IPTG concentration below 50 µM, and there was a progressive increase in colony size to the wild-type equivalent size at 500 µM IPTG. When IPTG was withdrawn from a broth culture, growth ceased within two generations, and then there was a marked loss of cell viability (Fig. 6B), confirming that secA is an essential gene in L. monocytogenes strain EGDe.
|
| DISCUSSION |
|---|
|
|
|---|
Through systematic changes to the electroporation protocol of Park and Stewart (53), we improved the efficiency of plasmid transfer in EGDe at least 125-fold, making it possible to routinely obtain direct integration of large pPL2-based plasmids (Fig. 3A). We also describe the highest level of electroporation competence described thus far for an L. monocytogenes strain, 2 x 107 CFU per µg for the serotype 4b isolate F2365. The enhancement of electroporation efficiency was due to a change in buffer, which improved cell integrity and allowed addition of a second cell wall-weakening step involving the enzymatic activity of lysozyme (Fig. 3B). The increase in competence of the sequenced strains made it easier to obtain transformants with larger plasmids and should enable new techniques, such as co-plasmid transformation, direct cloning of toxic genes, and genomic library construction, to be used directly for L. monocytogenes (32).
Serine and tyrosine phage integrases have been widely used for construction of site-specific integrative vectors (28). The integrase gene mediates crossover between the phage (attP) and bacterial (attB) attachment sites, disrupting the attB site on the chromosome, producing hybrid attBP/attPB at the junction sites. While numerous loci that can function for different integrases have been identified (22), there seems to be a preference for the targeting of conserved essential genes (e.g., the 3' end of tRNA codons). As observed with the PSA integrase of pPL2, integration results in recreation of the tRNA gene by the hybrid attBP site due to a 17-bp region of homology within attP. Recently, the integration sites of an additional three listeriophages were identified (31), and each phage had a novel site on the L. monocytogenes chromosome. Replacement of the int gene and attP recognition region of the PSA phage with the integrase from phage A006, A500, or B054 may generate a vector which could integrate at a secondary site on the chromosome, akin to the pPL1 vector integrating at the comK locus. The use of multiple integrative vectors has been described for other bacteria for genetic complementation and expression of heterologous genes (35, 45). However, as shown by Corr et al. (15), at least two DNA fragments can be inserted into the MCS of a pPL2 derivative for heterologous gene expression (bacteriocin immunity expression and luciferase reporter genes in this instance).
pPL2-derived overexpression (pLOV [63]) and IPTG-inducible (pLIV2 [33] and pLIV3 [1]) vectors were recently developed. The expression of promoterless genes is driven from the enhanced Hyper-SPO1 promoter (56) containing the 5' untranslated region of the L. monocytogenes hlyA gene, without the hlyA RBS. Genes are cloned containing their own RBS or a consensus RBS incorporated through oligonucleotide design. The two IPTG-inducible vectors are analogous to the two vectors described here, with one or two lacOid binding sites achieving stricter control of gene expression. The vectors described here for gene expression are an attractive alternative. The approach to cloning is streamlined as genes are expressed entirely from the plasmid machinery, there is no requirement for RBS inclusion in primer design, and therefore a gene can be cloned from a defined point (e.g., the start codon). This also allows direct comparison of levels of expression as identical constructs can be made in all three vectors. A dynamic range of invasion of 1,350-fold was determined for the three vectors (Fig. 2B). We have also used the pIMK2 system in Listeria to fully complement gene deletions by heterologous expression from the Phelp promoter (I. R. Monk, C. U. Riedel, P. G. Casey, C. Hill, and C. G. M. Gahan, unpublished).
Creation of clean markerless chromosomal mutations can be an arduous task, requiring the screening of thousands of colonies. Here we describe a protocol for chromosomal mutagenesis, which was developed for the pORI280 system but has also been applied to other thermosensitive plasmids, such as pKSV7. The procedure from the start of cloning to mutation confirmation can take as few as 10 days, and mutants are regularly obtained after the first passage at 30°C. In other protocols, the integration of the temperature-sensitive plasmid is stimulated by high-temperature incubation (at 39 to 43.5°C), often with passages at the high temperatures (11). This exposure to high temperature has been observed by others to stimulate spontaneous mutations in Listeria (68) and therefore should be avoided. Here we utilized a single temperature shift to 37°C, mediated by streaking a colony directly from the transformation plate for single colonies, and showed that this is sufficient to obtain plasmid integration. In addition, crossovers on both sides of the target site can be easily identified by the difference in blue coloration of a colony. The utility of the procedure was shown by the ability to generate gene deletions and single nucleotide changes in the chromosome (Fig. 4 and 5).
The first report of deletion of an essential gene in L. monocytogenes was published in 2006 (21). This was a noteworthy achievement, but the methodology was somewhat cumbersome as it involved the integration of a temperature-sensitive plasmid into lmo2537 (involved in teichoic acid synthesis), production of electrocompetent cells from the integrated strain, and then complementation with a temperature-sensitive IPTG-inducible vector, pLIV(lmo2537). The strain EGDe lmo2537aph3'containing pLIV(lmo2537) was unable to grow on BHI agar without IPTG supplementation. However, it did grow in BHI broth without IPTG, although there was a decrease in the final cell density. To show gene essentiality, we employed a streamlined approach facilitated by the pIMK4 vector. The deletion confirmed the essential nature of the secA gene, and there was a dramatic decrease in cellular viability upon withdrawal of IPTG (Fig. 6B). Improvements to the system would require cloning of an inducible counterselectable marker (58) into pORI280. This would improve the loss of the plasmid through the toxicity of the integrated plasmid when cultured on an appropriate substrate. Plasmid loss could be differentiated from spontaneous resistance by blue/white selection.
While this study was concerned primarily with tool development, several biologically relevant results are also reported here. We confirmed the essential nature of secA, we identified five additional PrfA "star" mutations, and we investigated the consequences of expressing inlA over a broad dynamic range for the invasion of Listeria. Lastly, we anticipate that the plasmids and methods outlined here will be a welcome addition to the postgenomic toolbox available to the Listeria research community.
| ACKNOWLEDGMENTS |
|---|
We acknowledge funding received from the Irish Government under National Development Plan 2000-2006 and funding for the Alimentary Pharmabiotic Centre provided by the Science Foundation of Ireland Centres for Science Engineering and Technology (CSET) program.
| FOOTNOTES |
|---|
Published ahead of print on 25 April 2008. ![]()
| REFERENCES |
|---|
|
|
|---|